Freigeisterhaus Foren-Übersicht www.artikeldrei.de
 FAQFAQ   SuchenSuchen   MitgliederlisteMitgliederliste   NutzungsbedingungenNutzungsbedingungen   BenutzergruppenBenutzergruppen   LinksLinks   ChatChat   RegistrierenRegistrieren 
 ProfilProfil   KarteKarte   Einloggen, um private Nachrichten zu lesenEinloggen, um private Nachrichten zu lesen   LoginLogin 

Gödel inspirierter Ansatz: "Systemtheorie meets Evolution"

 
Neues Thema eröffnen   Neue Antwort erstellen   Drucker freundliche Ansicht    Freigeisterhaus Foren-Übersicht -> Wissenschaft und Technik
Vorheriges Thema anzeigen :: Nächstes Thema anzeigen  
Autor Nachricht
Er_Win
>42<



Anmeldungsdatum: 31.01.2008
Beiträge: 1390
Wohnort: ja

Beitrag(#937600) Verfasst am: 20.02.2008, 12:00    Titel: Gödel inspirierter Ansatz: "Systemtheorie meets Evolution" Antworten mit Zitat

find ich interessant zu lesen:
http://www.heise.de/tp/r4/artikel/2/2364/1.html

Erwin
_________________
es genügt nicht keine eigene Meinung zu haben, man muss auch unfähig sein sie auszudrücken
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Botschafter Kosh
registrierter User



Anmeldungsdatum: 26.11.2007
Beiträge: 3166

Beitrag(#937847) Verfasst am: 20.02.2008, 18:50    Titel: Re: Gödel inspirierter Ansatz: "Systemtheorie meets Evolution" Antworten mit Zitat

Er_Win hat folgendes geschrieben:
find ich interessant zu lesen:
http://www.heise.de/tp/r4/artikel/2/2364/1.html

Erwin


"Auch wenn dies noch längst nicht allgemein anerkannt wird, entsteht allmählich ein Bild von problemlösenden Bakterien, die ihr Genom an von der Umwelt gestellten Problemen anpassen können. Das ist ein radikal anderes Bild als das herrschende von der unlebendigen, passiven DNA, die als Speicher zur Herstellung von Proteinen dient."
Aus:s.o.

Denk mal über unsere Argumentationen nach wo ich behauptet habe ein Mem kann Einfluss auf eine einzelne Zelle (Gen)haben.

mfg Kosh
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
November
11. Monat



Anmeldungsdatum: 25.11.2006
Beiträge: 151

Beitrag(#937965) Verfasst am: 20.02.2008, 22:48    Titel: Antworten mit Zitat

Keine Bakterie muss für sich alleine ein Problem lösen ...

Bakterienkolonien funktionieren wie ein einziger Organismus.
Das ganze System ist bis heute so vernetzt, dass alle Bakterien trotz ihrer asexuellen Vermehrung einen gemeinsamen Genpool darstellen. Bakterien sind funktional unsterblich.
Im Falle von Strahlenschäden kommen Reparaturenzyme zum Einsatz, dabei benutzen Bakterien aber nicht ihre eigene DNS zur Reparatur, sondern borgen von benachbarten Bakterien DNS-Fragmente, so dass sich ein ständiger Genaustausch untereinander abspielt.
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
wurstface
registrierter User



Anmeldungsdatum: 10.03.2005
Beiträge: 59
Wohnort: München

Beitrag(#938373) Verfasst am: 21.02.2008, 15:56    Titel: Antworten mit Zitat

Zitat:

Wenn wir jedoch Wissenschaft als die Möglichkeit verstehen, auf der Grundlage des gegenwärtigen Wissens über ein System dessen künftigen Zustand und künftiges Verhalten vorherzusagen, dann widerspricht ein kreativer Prozeß den Glaubenssätzen der Wissenschaft. Schließlich bedeutet Kreation die Emergenz von etwas Neuem und Unvorhersehbarem, das sich nicht unmittelbar aus dem Gegenwärtigen herleiten läßt.


Hier hab ich aufgehört zu lesen. Was ein Quatsch.. Hört sich beim Überfliegen ein wenig nach Lamarckismus an?
_________________
"I find the whole business of religion profoundly interesting, but it does mystify me that otherwise intelligent people take it seriously" Douglas Adams
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Halligstorch
Skeptischer Schwärmer



Anmeldungsdatum: 02.02.2006
Beiträge: 1210

Beitrag(#939575) Verfasst am: 22.02.2008, 17:27    Titel: Antworten mit Zitat

wurstface hat folgendes geschrieben:
Zitat:

Wenn wir jedoch Wissenschaft als die Möglichkeit verstehen, auf der Grundlage des gegenwärtigen Wissens über ein System dessen künftigen Zustand und künftiges Verhalten vorherzusagen, dann widerspricht ein kreativer Prozeß den Glaubenssätzen der Wissenschaft. Schließlich bedeutet Kreation die Emergenz von etwas Neuem und Unvorhersehbarem, das sich nicht unmittelbar aus dem Gegenwärtigen herleiten läßt.


Hier hab ich aufgehört zu lesen. Was ein Quatsch.. Hört sich beim Überfliegen ein wenig nach Lamarckismus an?


Die Emergenz bzw. Entstehung von etwas Unvorsehbaren ist ziemlich das genaue Gegenteil von Lamarckismus. Deine Bemerkung zeigt aber, was dabei herauskommt, wenn man die Welt in Lamarckisten, Darwinisten und Intelligent Design-Anhänger einteilt, nämlich gar nix.

Gruß

Halligstorch
_________________
»Monotheisten, Fundamentalisten, Kreationisten sind nur dann gefährlich, wenn sie sich von der Intoleranz heutiger Atheisten anstecken lassen und wie diese Atheisten auf eine einzige Wahrheit für alle bestehen.«
Richard Rorty, amerikanischer Philosoph

http://www.kritische-naturgeschichte.de
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden Website dieses Benutzers besuchen
Er_Win
>42<



Anmeldungsdatum: 31.01.2008
Beiträge: 1390
Wohnort: ja

Beitrag(#939592) Verfasst am: 22.02.2008, 17:46    Titel: Antworten mit Zitat

Zitat:
Hört sich beim Überfliegen ein wenig nach Lamarckismus an?

? also entweder versteh ich dann C. de Lamarck nicht, oder du hattest beim Überfliegen doch eine zu große Höhe, da erkennt man die Dinge nur mehr schemenhaft und der Mustererkennungsprozess kann in der falschen "Schublade" münden ... zwinkern

Erwin
_________________
es genügt nicht keine eigene Meinung zu haben, man muss auch unfähig sein sie auszudrücken
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
wurstface
registrierter User



Anmeldungsdatum: 10.03.2005
Beiträge: 59
Wohnort: München

Beitrag(#939758) Verfasst am: 22.02.2008, 20:46    Titel: Antworten mit Zitat

Zitat:
"Auch wenn dies noch längst nicht allgemein anerkannt wird, entsteht allmählich ein Bild von problemlösenden Bakterien, die ihr Genom an von der Umwelt gestellten Problemen anpassen können. Das ist ein radikal anderes Bild als das herrschende von der unlebendigen, passiven DNA, die als Speicher zur Herstellung von Proteinen dient."


grrrr das FGH hat gerade meine recht ausfürliche Antwort im Äther verschwinden lassen..
dann eben nur stichpunktartig:

-Ich teile die Welt nicht in irgendwelche Lager ein, sondern habe nur eine Assoziation ausgesprochen.

-Ist die "adaptive Mutation"(aktive Anpassung des Genoms an die Umwelt) nicht Basis des Lamarckismus?

-siehe Post von November, Bakterien besitzen durch horizontalen Gentransfer einen gemeinsamen Genpool, keine Veranlassung das Genom als eine "adaptive kybernetische Einheit mit Selbstwahrnehmung(?)" zu postulieren.

-Frage an die Experten: Wieso kann es in einem deterministischen Universum nicht zu Emergenz kommen? Hat jemand eine Buch/Artikel Empfehlung zu dem Thema?

Mfg, wf.
_________________
"I find the whole business of religion profoundly interesting, but it does mystify me that otherwise intelligent people take it seriously" Douglas Adams
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Mr Schnuffi
Faule Schäfer haben gute Hunde.



Anmeldungsdatum: 18.02.2007
Beiträge: 827

Beitrag(#939781) Verfasst am: 22.02.2008, 21:22    Titel: Antworten mit Zitat

Der Lamarckismus unterstellt dem Individuum einen "Willen" zur Adaption (Giraffen strecken ihre Hälse nach Blättern, deshalb habe die Nachkommen längere Hälse etc.)
_________________
Das Leben ist ein Hund, mal schwarz mal weiß mal kunterbunt

"Kleine pubertierende Mädchen, alte senile Weiber und Christen reden also meistens nicht, um Nachrichten und Informationen zu übermitteln, sondern nur um ihre Stimmung zu steigern! " Bondy, verschollene Userin
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
November
11. Monat



Anmeldungsdatum: 25.11.2006
Beiträge: 151

Beitrag(#939800) Verfasst am: 22.02.2008, 22:03    Titel: Antworten mit Zitat

wurstface hat folgendes geschrieben:


-Frage an die Experten: Wieso kann es in einem deterministischen Universum nicht zu Emergenz kommen? Hat jemand eine Buch/Artikel Empfehlung zu dem Thema?

Mfg, wf.


Lebensnetz von Fritjof Capra (Original: The Web of Life, 1996)

Bin kein Experte - habe deshalb leider nicht viel davon verstanden ... fand es aber trotzdem faszinierend.

http://www.fritjofcapra.net/

Und was ist mit der Gaia-Theorie ? (oder Gaya)
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Darwin Upheaval
Evo-Devo-Darwinist



Anmeldungsdatum: 23.01.2004
Beiträge: 5424
Wohnort: Tief im Süden

Beitrag(#943545) Verfasst am: 28.02.2008, 13:11    Titel: Antworten mit Zitat

wurstface hat folgendes geschrieben:
-Frage an die Experten: Wieso kann es in einem deterministischen Universum nicht zu Emergenz kommen? Hat jemand eine Buch/Artikel Empfehlung zu dem Thema?


Entgegen der landläufigen Meinung hat der Begriff "Emergenz" mit dem Determinismus, mit der Bestimmtheit oder Unbestimmtheit eines Prozesses, nichts zu tun. Unter Emergenz versteht man einfach das Entstehung qualitativ neuer Systemeigenschaften, die die Komponenten des Systems nicht besitzen (Konrad Lorenz prägte hierzu den Begriff "Fulguration", der sich aber nicht durchgesetzt hat).

Ein einfaches Beispiel sind die physikalisch-chemischen Eigenschaften von Wasser: sein vergleichsweise hoher Siedepunkt, seine hohe Wärmekapazität, das anomale Dichtemaximum bei 4 °C etc. Diese Eigenschaften resultieren aus den Bindungsverhältnissen zwischen Wasserstoff und Sauerstoff sowie aus den zwischen den Molekülen ausgebildeten Wasserstoffbrücken und lassen sich auch streng vorhersagen, sind aber trotzdem emergent. Weder ist ein einzelnes Wassermolekül flüssig, noch besitzt es eine Dichteanomalie, noch besitzt eine Mischung aus Wasserstoff und Sauerstoff die Eigenschaften von Wasser.

Falls Du Literatur suchst, kann ich

Bunge, M.; Mahner, M. (2004) Über die Natur der Dinge. Materialismus und Wissenschaft. S. Hirzel, Stuttgart

nur wärmstens empfehlen. Das Buch ist zwar nicht gerade leichte Kost (und repräsentiert auch nicht immer den mainstream), aber es enthält die am stringentesten ausformulierte Ontologie, die ich kenne.
_________________
"Der Wandteppich, den die Naturwissenschaft webt, wenn sie die Evolution unseres Universums darstellt, ist weit farbiger und faszinierender als alle Bilder aus Offenbarungen oder den phantasievollen Geschichten, die Menschen ausgeheckt haben." - Lawrence M. Krauss

www.ag-evolutionsbiologie.de
www.facebook.com/AGEvolutionsbiologie
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Halligstorch
Skeptischer Schwärmer



Anmeldungsdatum: 02.02.2006
Beiträge: 1210

Beitrag(#943810) Verfasst am: 28.02.2008, 19:23    Titel: Antworten mit Zitat

Darwin Upheaval hat folgendes geschrieben:
wurstface hat folgendes geschrieben:
-Frage an die Experten: Wieso kann es in einem deterministischen Universum nicht zu Emergenz kommen? Hat jemand eine Buch/Artikel Empfehlung zu dem Thema?


Entgegen der landläufigen Meinung hat der Begriff "Emergenz" mit dem Determinismus, mit der Bestimmtheit oder Unbestimmtheit eines Prozesses, nichts zu tun. Unter Emergenz versteht man einfach das Entstehung qualitativ neuer Systemeigenschaften, die die Komponenten des Systems nicht besitzen (Konrad Lorenz prägte hierzu den Begriff "Fulguration", der sich aber nicht durchgesetzt hat).

Ein einfaches Beispiel sind die physikalisch-chemischen Eigenschaften von Wasser: sein vergleichsweise hoher Siedepunkt, seine hohe Wärmekapazität, das anomale Dichtemaximum bei 4 °C etc. Diese Eigenschaften resultieren aus den Bindungsverhältnissen zwischen Wasserstoff und Sauerstoff sowie aus den zwischen den Molekülen ausgebildeten Wasserstoffbrücken und lassen sich auch streng vorhersagen, sind aber trotzdem emergent. Weder ist ein einzelnes Wassermolekül flüssig, noch besitzt es eine Dichteanomalie, noch besitzt eine Mischung aus Wasserstoff und Sauerstoff die Eigenschaften von Wasser.

Falls Du Literatur suchst, kann ich

Bunge, M.; Mahner, M. (2004) Über die Natur der Dinge. Materialismus und Wissenschaft. S. Hirzel, Stuttgart

nur wärmstens empfehlen. Das Buch ist zwar nicht gerade leichte Kost (und repräsentiert auch nicht immer den mainstream), aber es enthält die am stringentesten ausformulierte Ontologie, die ich kenne.



Wenn so ein Unsinn in dem Buch von Bunge u. Mahner steht, dann solltest Du Dir lieber das Buch "Abschied von der Weltformel" von Robert B. Laughlin kaufen.

Wenn es möglich ist alle Eigenschaften des Wassers, aus Eigenschaften von Wassermolekülen streng vorherzusagen, dann ist Wasser kein Beipspiel für Emergenz. Emergenz bedeutet, dass man die Sprachebene wechseln muss, weil zu. B. bei der Beschreibung der Eigenschaften einer makroskopischen Phase wie Wasser die atomare oder molekulare also die reduktionistische Ebene versagt:

Laughlin führt die Phase "Wassereis" folgendes Beispiel an:

Zitat:
"Normales Wassereis weist nach letzter Zählung (die Zahl wird aufgrund neuer Entdeckungen ständig größer) elf unterscheidbare kristalline Phasen auf, von denen keine einzige aus grundliegenden Prinzipien heraus vorgesagt worden ist".


Sollten Bunge u. Mahner tatsächlich geschrieben haben, dass man aufgrund reduktionistischer atomarer oder molekularer Eckdaten alle Phasen und ihre Übergänge streng vorhersagen kann, dann scheint mir die Ursache dafür in allerheiligsten reduktionistischen synthetischen Evolutionstheorie zu liegen. Die ist ja auch dem Glauben verfallen, emergente Phänome wie Organe oder Lebewesen auf der mikroskopischen Ebene (Mutation und Selektion) erklären zu können.

Da wissen wir doch gleich, woher der reduktionistische Wind weht...

Gruß

Halligstorch
_________________
»Monotheisten, Fundamentalisten, Kreationisten sind nur dann gefährlich, wenn sie sich von der Intoleranz heutiger Atheisten anstecken lassen und wie diese Atheisten auf eine einzige Wahrheit für alle bestehen.«
Richard Rorty, amerikanischer Philosoph

http://www.kritische-naturgeschichte.de
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden Website dieses Benutzers besuchen
Botschafter Kosh
registrierter User



Anmeldungsdatum: 26.11.2007
Beiträge: 3166

Beitrag(#943819) Verfasst am: 28.02.2008, 19:46    Titel: Antworten mit Zitat

Mr Schnuffi hat folgendes geschrieben:
Der Lamarckismus unterstellt dem Individuum einen "Willen" zur Adaption (Giraffen strecken ihre Hälse nach Blättern, deshalb habe die Nachkommen längere Hälse etc.)


Dem kommt die Auffassung Problem lösender und ihren Genpool anpassender Bakterien doch ziemlich nahe.
Wenn man sich ein Problem als Mem ( nicht angeborener Balzgesang) denkt, welches sich als Lösung in den Genen wiederfindet (angeborener Balzgesang) stellt das eine Synthese der Theorien von Darwin und Lamarck dar.
Die Individuen sind "Schöpfer" ihrer selbst und geben der Evolution gewissermaßen eine sinnvolle (Problem lösende)Richtung. Dadurch verlieren die Auffassungen von Mutation und Selektion als Wirkungsmechanismen nicht ihre Bedeutung.

mfg Kosh
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Mr Schnuffi
Faule Schäfer haben gute Hunde.



Anmeldungsdatum: 18.02.2007
Beiträge: 827

Beitrag(#943894) Verfasst am: 28.02.2008, 21:51    Titel: Antworten mit Zitat

Botschafter Kosh hat folgendes geschrieben:
Mr Schnuffi hat folgendes geschrieben:
Der Lamarckismus unterstellt dem Individuum einen "Willen" zur Adaption (Giraffen strecken ihre Hälse nach Blättern, deshalb habe die Nachkommen längere Hälse etc.)


Dem kommt die Auffassung Problem lösender und ihren Genpool anpassender Bakterien doch ziemlich nahe.
Wenn man sich ein Problem als Mem ( nicht angeborener Balzgesang) denkt, welches sich als Lösung in den Genen wiederfindet (angeborener Balzgesang) stellt das eine Synthese der Theorien von Darwin und Lamarck dar.
Die Individuen sind "Schöpfer" ihrer selbst und geben der Evolution gewissermaßen eine sinnvolle (Problem lösende)Richtung. Dadurch verlieren die Auffassungen von Mutation und Selektion als Wirkungsmechanismen nicht ihre Bedeutung.

mfg Kosh


Ich würde jetzt mal spontan zustimmen, dass kulturelle Evolution (also die Geschichte mit den Memen) wirklich lamarckistisch verläuft, oder jedenfalls zum großen Teil.
Aber was hat das mit Bakterien zu tun? Bakterien haben keinen Willen, sie verfolgen auch kein Ziel, sie können nur im Rahmen genetischer Schranken auf ihre Umwelt reagieren. Diese Reaktionen können recht ausgepufft sein, und auch emergente Eigenschaften können in einer Population von Bakterien auftreten (Quorum sensing), nur mit Lamarckismus, soweit ich ihn verstanden habe, hat das nichts zu tun.
Naja, werde mir entsprechenden Artikel noch einmal durchlesen.....

Edit:
Mit dem Balzgesang... Eine Synthese von Darwin und Lamarck würde eine genetische Fixierung des erlernten Balzgesangs bedingen. Kennt ihr den Schleierschwanz? Ein interessantes Video gibt es im englischen Wiki dazu (Suche: Lyrebird).

Adaptive Mutation: Wenn sich das Genom zielgerichtet (also auf direktem Wege) ändert, dann Lamarck, wenn nicht, dann Darwin. Mir scheint (beim Überfliegen in mittlere Höhe), dass Eshel Ben-Jacob der Chemikalie DNA Eigenschaften zugesteht, die etwa mystisch sind.
_________________
Das Leben ist ein Hund, mal schwarz mal weiß mal kunterbunt

"Kleine pubertierende Mädchen, alte senile Weiber und Christen reden also meistens nicht, um Nachrichten und Informationen zu übermitteln, sondern nur um ihre Stimmung zu steigern! " Bondy, verschollene Userin
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Monist
verhinderter Möchtegernhedonist



Anmeldungsdatum: 04.06.2013
Beiträge: 37

Beitrag(#1950786) Verfasst am: 17.09.2014, 11:59    Titel: Mit Gödel kann man auch Gott beweisen Antworten mit Zitat

Habe mal nach Gödel gegoogelt und diesen alten Thread samt dem Artikel gefunden.
Die Aussage über Gödels Theorem:
Eshel Ben-Jacob hat folgendes geschrieben:

Es besagt, einfach ausgedrückt, daß ein System nicht ein anderes System bilden kann, das komplexer als es selbst ist.

stimmt so ja nicht für Lebewesen, da es sich zum Einen um ein abstraktes, mathematisches Theorem handelt,
was zum Anderen wenn überhaupt nur für geschlossene, physikalische Systeme gelten würde (oder verbietet Gödel Emergenz?).

Überhaupt halte ich die ganzen "Systemtheorien" angesichts der unvorstellbaren Komplexität
der neuronalen Vernetzung bereits eines MenschenGehirnes mit 100000000000 Neuronen und
10000000000000000000 Synapsen (!) für mehr als Spekulation um sie aus dem Mikroskopischen
Quantenmechanik-Kosmos bis auf globalisierte Gesellschaften mit 8 Milliarden Menschen und einer
Gesamtanzahl von somit unvorstellbaren 80000000000000000000000000000 Synapsen anzuwenden.

Zur Zeit lese ich gerade widerwillig Kaiser's Abhandlungen über den Zufall und da ist es schon
erstaunlich wie man vom Radioaktiven Zerfall (wobei ich zugeben muss, dass ich als etwas deterministisch
Denkender wie Einstein beim Verstehen des "objektiven Zufalls", also der Kopenhagener Deutung des akausalen
radioaktiven Zerfalls, da ich auch dachte, dass Gott nicht würfelt, so meine Probleme habe) über die Verunglimpfung
der Ergebnisse der Hirnforschung über den freine Willen hin zur Notwendigkeit einer marxistisch-leninistischen,
kommunistischen Weltordnung kommen muss.
(suche da noch Links zu einem aktuell als sicherer und vernünftigerer anerkannten naturwissenschaftlichen
Weltbild und bin auch dankbar fü Tips hier).

Was den Artikel angeht, so ist ja in der Tat in letzter Zeit in der Epigenetik viel über
Genregulation, Alternative Splicing, Präadaptation und Transposonen entdeckt worden.
Das alles wegen der so gearteten "Kommunikation" zwischen den Zellen als kreatives genomisches Netz zu
bezeichnen, mag ja noch angehen, aber nicht Gödel da wie oben systemtheoretisch zu verifizieren oder falsifizieren.

Im übrigen läßt sich meiner Meinung nach mit abstrakter, philosophisch-mathematischer Logik so
ziemlich alles Fabulatorische (z.B. durch Fehlinterpretation der Mengenlehre bei Markus Gabriel:
Warum es die Welt nicht gibt) "beweisen" bzw. systemtheoretisieren, so wie Gödel ja auch Gott = G(x) "bewiesen" hat:
Gödel hat folgendes geschrieben:

Definition 1: Ein Wesen ist göttlich, wenn es alle positiven Eigenschaften besitzt.
Definition 2: Eine Eigenschaft eines Wesens heißt wesentlich, wenn alle weiteren Eigenschaften dieses Wesens daraus notwendig folgen.
Definition 3: Ein Wesen existiert notwendig, wenn alle seine wesentlichen Eigenschaften notwendig sind.
Axiom 1: Jede Eigenschaft ist entweder positiv oder nicht positiv.
Axiom 2: Was notwendig eine positive Eigenschaft enthält, ist selber positiv.
Theorem 1: Ist eine Eigenschaft positiv, so ist es möglich, dass es etwas gibt, das diese Eigenschaft besitzt.
Axiom 3: Göttlichkeit ist eine positive Eigenschaft.
Theorem 2: In einer möglichen Welt ist ein göttliches Wesen logisch möglich.
Axiom 4: Jede positive Eigenschaft ist notwendig positiv.
(Dies bedeutet, dass Notwendigkeit in der Positivität einer Eigenschaft enthalten ist. Somit ist Notwendigkeit selbst eine positive Eigenschaft.)
Theorem 3: Wenn ein Wesen göttlich ist, dann ist seine Göttlichkeit eine wesentliche Eigenschaft.
(Daraus folgt, dass es höchstens ein göttliches Wesen geben kann.)
Axiom 5: Die Eigenschaft der notwendigen Existenz ist positiv.
Theorem 4: Wenn die Existenz eines göttlichen Wesens logisch möglich ist, dann ist sie notwendig.
(Da die logische Möglichkeit der Göttlichkeit bereits in Theorem 2 festgestellt wurde, folgt nun, dass genau ein göttliches Wesen notwendig existiert.)


_________________
CGTATGACACGAGCATCAGAGATGATATGCGAGAGCAGACGCAGTGCATCAGCGCACAGATATATGCGAGCGATAGTGCACACTCTCGCGTGTCTACTGAGTGAGCTGATATAGCGTCGAGCGACGTCGATCGATCATGTAGCGACTGTGTCATCTAGTGCTGTGTATCGCTCTCGTAGTGCAGCGAGTCGTGCGC
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
zelig
Kultürlich



Anmeldungsdatum: 31.03.2004
Beiträge: 19329

Beitrag(#1950789) Verfasst am: 17.09.2014, 12:26    Titel: Re: Mit Gödel kann man auch Gott beweisen Antworten mit Zitat

Monist hat folgendes geschrieben:
Habe mal nach Gödel gegoogelt und diesen alten Thread samt dem Artikel gefunden.
Die Aussage über Gödels Theorem:
Eshel Ben-Jacob hat folgendes geschrieben:

Es besagt, einfach ausgedrückt, daß ein System nicht ein anderes System bilden kann, das komplexer als es selbst ist.

stimmt so ja nicht für Lebewesen, da es sich zum Einen um ein abstraktes, mathematisches Theorem handelt,
was zum Anderen wenn überhaupt nur für geschlossene, physikalische Systeme gelten würde (oder verbietet Gödel Emergenz?).[...]


Wenn das Folgesystem als Untermenge des Ursprungssytem verstanden wird, dann scheint mir die Aussage intuitiv korrekt zu sein. Jedoch könnte man einwenden, daß die Mittel, die zur Beschreibung des Gesamtsystems langen würden, für die Beschreibung des Untersystems nicht ausreichen. Und infolge dessen existierte keine Möglichkeit einer einheitlichen Beschreibung der Realität.
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Shadaik
evolviert



Anmeldungsdatum: 17.07.2003
Beiträge: 26121
Wohnort: MG

Beitrag(#1950791) Verfasst am: 17.09.2014, 12:34    Titel: Re: Mit Gödel kann man auch Gott beweisen Antworten mit Zitat

zelig hat folgendes geschrieben:
Monist hat folgendes geschrieben:
Habe mal nach Gödel gegoogelt und diesen alten Thread samt dem Artikel gefunden.
Die Aussage über Gödels Theorem:
Eshel Ben-Jacob hat folgendes geschrieben:

Es besagt, einfach ausgedrückt, daß ein System nicht ein anderes System bilden kann, das komplexer als es selbst ist.

stimmt so ja nicht für Lebewesen, da es sich zum Einen um ein abstraktes, mathematisches Theorem handelt,
was zum Anderen wenn überhaupt nur für geschlossene, physikalische Systeme gelten würde (oder verbietet Gödel Emergenz?).[...]


Wenn das Folgesystem als Untermenge des Ursprungssytem verstanden wird, dann scheint mir die Aussage intuitiv korrekt zu sein. Jedoch könnte man einwenden, daß die Mittel, die zur Beschreibung des Gesamtsystems langen würden, für die Beschreibung des Untersystems nicht ausreichen. Und infolge dessen existierte keine Möglichkeit einer einheitlichen Beschreibung der Realität.

Die Frage ist, ob ein System in sich selbst komplexer werden kann. Die meisten Schöpfungen und auch zB der Fortpflanzungsprozess (und damit die Evolution) lassen sich mE durchaus so darstellen, dass die innere Komplexität eines Systems steigt, bevor sich das System in mehrere weniger komplexe auftrennt.
_________________
Fische schwimmen nur in zwei Situationen mit dem Strom: Auf der Flucht und im Tode
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden Website dieses Benutzers besuchen Yahoo Messenger ICQ-Nummer
Klaus-Peter
Kritischer Rationalist



Anmeldungsdatum: 10.01.2004
Beiträge: 948

Beitrag(#1950832) Verfasst am: 17.09.2014, 15:59    Titel: Antworten mit Zitat

Darwin Upheaval hat folgendes geschrieben:

Ein einfaches Beispiel sind die physikalisch-chemischen Eigenschaften von Wasser: sein vergleichsweise hoher Siedepunkt, seine hohe Wärmekapazität, das anomale Dichtemaximum bei 4 °C etc. Diese Eigenschaften resultieren aus den Bindungsverhältnissen zwischen Wasserstoff und Sauerstoff sowie aus den zwischen den Molekülen ausgebildeten Wasserstoffbrücken und lassen sich auch streng vorhersagen...

Wenn Du das irgendwo gelesen hast, dann würde mich eine Quelle brennend interessieren. Ich würde nach jetzigem Kenntnisstand eher darauf tippen, dass das nicht möglich ist.

Ohne die sonstigen erkenntnistheoretischen Positionen des Halligstorches auch nur annähernd zu teilen, muss ich seiner Bemerkung über die hohe Qualität des Buchs von Laughlin (das man gelesen haben muss) zustimmen.
_________________
Zum Denken sind wenige Menschen geneigt, obwohl alle zum Rechthaben. (Arthur Schopenhauer)
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Klaus-Peter
Kritischer Rationalist



Anmeldungsdatum: 10.01.2004
Beiträge: 948

Beitrag(#1950835) Verfasst am: 17.09.2014, 16:11    Titel: Antworten mit Zitat

Was den verlinkten Beitrag des Treaderöffners betrifft:

Einen Aufsatz, der mit der Behauptung anfängt, die Kernaussage des heutigen "reduktionistischen Ansatzes in der Philosophie" sei:
"Das Universum ist das mechanische Universum von Laplace, in dem es keinen Platz für Erneuerung oder Kreativität gibt. Die Annahme ist im Gegenteil, daß sich die Systeme in der Natur, wenn man sie unbehelligt läßt, der maximalen Entropie nach dem Zweiten Gesetz der Thermodynamik nähern. ",
den lese ich nicht weiter.

Oder um Wanda Gershwitz aus dem Film "Ein Fisch namens Wanda" zu zitieren: "Aristoteles war kein Belgier. Die Kernbotschaft des Buddhismus lautet nicht: 'Jeder kämpft für sich allein'. Und die 'London Underground' ist keine politische Bewegung. Otto, ich habe das nachgeschlagen!"
_________________
Zum Denken sind wenige Menschen geneigt, obwohl alle zum Rechthaben. (Arthur Schopenhauer)
Nach oben
Benutzer-Profile anzeigen Private Nachricht senden
Beiträge der letzten Zeit anzeigen:   
Neues Thema eröffnen   Neue Antwort erstellen   Drucker freundliche Ansicht    Freigeisterhaus Foren-Übersicht -> Wissenschaft und Technik Alle Zeiten sind GMT + 1 Stunde
Seite 1 von 1

 
Gehe zu:  
Du kannst keine Beiträge in dieses Forum schreiben.
Du kannst auf Beiträge in diesem Forum nicht antworten.
Du kannst deine Beiträge in diesem Forum nicht bearbeiten.
Du kannst deine Beiträge in diesem Forum nicht löschen.
Du kannst an Umfragen in diesem Forum nicht mitmachen.



Disclaimer / Impressum


Powered by phpBB © 2001, 2005 phpBB Group